justinap444 justinap444

07-04-2020
Biology

contestada

Write the complementary sequence to following DNA strand: AATTGCGATCGCTCGTACCGG

Respuesta :

aleecha107 aleecha107

07-04-2020

Answer:

TTAACGCTAGCGAGCATGGCC

Explanation:

A and T pair together, and G and C are pairs. Whenever you see one of them in the original sequence, you'd just write the other one for the complementary sequence.

Answer Link

Otras preguntas

Justin uses 4 right angles to draw a polygon. How many different polygons can he make?

Renee is good at juggling because she is ambidextrous. What does the word ambidextrous mean in the sentence above? well balanced extremely flexible double joint

In "Honest Work," which best explains why the old smith carefully forges each link of the ship's chain? A. He believes the ship will be caught in a storm very

what is the proper name for NH4C2H3O2?

Negative feedback loops act to _________________? A. cause milk production after childbirth. B. cause expulsion of milk during breastfeeding. C. cause an ere

In figure , a || e , m || n , and m 1=108 degrees What's m 3 ? _____ degrees

Which two units of measurement are commonly used to measure heat?

solve the system of linear equations. y=x-5 y=-2x+1

How did Pericles change democracy athens

The perimeter of a rectangle is 256 m. The length is 16 m greater than the width. What is the width of the rectangle?