anugrahmshibu2007 anugrahmshibu2007

13-04-2020
Mathematics

contestada

The digit at unit’s place of square of 876543 is

Respuesta :

ChillMuse ChillMuse

13-04-2020

The digit is 9. This is because 3 is in the unit's place of the original number, and 3 squared is equal to 9. Therefore, 9 will be in the unit's place of the square of the original number.

Answer Link

Otras preguntas

At a local baseball game there are 3 hot dog vendors. collectively the vendors sold 1,700 hot dogs. if vendor a sold 456, vendor b sold 607, and vendor c sold 6

Identify two things organisms compete with one for another

Angles α and β are the two acute angles in a right triangle. Use the relationship between sine and cosine to find the value of α if α < β. sin(2x − 8) = cos

The 14th amendment provides that no "state [shall] deprive any person of life, liberty, or property, without due process of law; nor deny to any person within i

Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequences are always written 5' to 3

Read the excerpt from The Land, Part 2. None of us spoke right up. I knew that was because we all had the same fear. My daddy's voice was soft, but we knew his

Yasmin purchased 6 heads of cabbage that each weighed 2 (3/8) pounds. How much did the cabbage weigh all together?

N a man's world, how does crothers portray frank, the female protagonist? as a rigid and overbearing woman who seeks to live on her own terms as an angry and di

Megachurches have become popular in certain parts of the united states. where else in the world are megachurches widely popular?

A pop star is coming for a live concert in your area. The ticket proceeds will benefit a nonprofit organization helping underprivileged children interested in m