camilamartinez92206 camilamartinez92206

09-10-2020
Mathematics

contestada

What is the reflection of -3,3 over the y axis

Respuesta :

johnathw johnathw

09-10-2020

Answer:

3,-3 on x axis

Step-by-step explanation:

Answer Link

Otras preguntas

Determine the wavelength of the light absorbed when an electron in a hydrogen atom makes a transition from an orbital in which n = 2 to an orbital in which n =

Given: △ABC, AB=5 2 m∠A=45°, m∠C=30° Find: BC and AC Answer ASAPPP!! I need it by 9 pm!

How did the transatlantic flight by Charles Lindbergh affect American aviation? A. It persuaded Americans to travel more often and learn more about the cultur

Which mRNA sequences would form a structure that is a cue for transcription termination of some genes? 5 ′ − GGCCCUUUUAGGGCCAAAAA − 3 ′ a sequence of uracil–ade

Which of the following is the most important body of water to Southern Europe? A) Black Sea B) Mediterranean Sea C) Atlantic Ocean D) Dead Sea

Tom currently has 5 comic books in his collection and has subscribed to receive 5 new comic books each month. His uncle has 145 comic books, but sends five t

Chen incurred $58,500 of interest expense this year related to his investments. His investment income includes $15,000 of interest, $9,000 of qualified dividend

Sandra counted the number of legs walking in the park she counted a total of 7 people and some dogs each person had two legs and each dog had four legs they wer

The two intervals (114.8, 115.4) and (114.5, 115.7) are confidence intervals (computed using the same sample data) for μ = true average resonance frequency (in

Unemployment is studied as a part of