araujomaggiee araujomaggiee

08-02-2021
Mathematics

contestada

Which two statements are true

Which two statements are true class=

Respuesta :

Hrishii Hrishii

08-02-2021

Answer:

Only 2nd option is the correct answer.

There is no other correct option given.

Step-by-step explanation:

Hope it helps you in your learning process.

Answer Link

Otras preguntas

2. What is the name of the battle that D-Day is associated with?

The Wilson Company purchased $44,000 of merchandise from the Poole Wholesale Company. Wilson also paid $3,000 for freight costs to have the goods shipped to its

Denaturation of Nucleic Acids A duplex DNA oligonu-cleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG has a melting temperature (tm) of

Ford every decisión You Make, there is a trade offtruefalse

A man who is 6 feet tall is standing under a streetlight and casts a shadow on the sidewalk. The man is standing 15 feet away from the 20-foot streetlight. How

International trade a. raises the standard of living for importing countries and lowers it for exporting countries. b. raises the standard of living in all trad

A restaurant manager has estimated that the price elasticity of demand for meals is 2. If the restaurant increases menu prices by 5%, she can expect the number

(x+d)(x+e)=x^2+fx+33 In the equation above, d, e, and f are positive constants.Which of the following are possible integer values of f? a) f= 0 or 1 b) f= 1 or

With its wheels locked, a van slides down a hill inclined at 40.0° to the horizonta l. Find the acceleration of this van A) if the hill is icy and frictionless,

In which two ways would the story be different if it were told from the point of view of Matthew?