badbimffffcurlzzzzzz badbimffffcurlzzzzzz

08-02-2021
Mathematics

contestada

Factor the algebraic expression. 9a+21

Respuesta :

favalinasebastian198 favalinasebastian198

08-02-2021

Step-by-step explanation:

1. factor 3 out of 9a + 21

answer: 3(3a + 7)

Answer Link

Otras preguntas

PLEASE HELP!!!what is the length of segment SR? units

You observe an individual of your favorite study organism expressing the dominant phenotype for a certain trait. how would you go about determining if the indiv

The law of conservation of mass states that in a chemical reaction, mass is neither created nor destroyed. that means, the total mass for the reactants needed t

Which of the following accurately describes most morality plays? Select all that apply.Uses allegorical charactersFocuses on presenting evil characters and thei

Name the type of funeral music characterized by slow, sad, music being played before interment followed by upbeat, celebratory, music afterwards? Where did this

The seeds of individualism and collectivism are found in the _________ in which a person grows up.

Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequences are always written 5' to 3

The wife nags at her husband because he constantly withdraws from her. the husband withdraws, because he feels that his wife is nagging all the time. the differ

Use the gauss-Jordan method to solve the system of equations x+y-5z=-68 2x-y+3z=19 x-2y+2z=-15

Frank, age 67, recites a poem that he learned in grade school, much to the amazement of his grandchildren. this is an example of frank's _____ memory.