einesundeido einesundeido

12-02-2021
Physics

contestada

Why can you hear a man's voice around the corner of a building even if you can't see him?
OA. Interference

Respuesta :

sageeeee sageeeee

20-02-2021

Answer:

Diffraction

Explanation:

the sound bounces off the corner and we are able to hear it

A P E X

Answer Link

Otras preguntas

what does nucleus do inside a cell?a.protective coveringb.stores food,water,wastec.control center that directs cell activitiesd.produces protein (on ER)

A stabbing victim sustained a perforation to his large intestine. from the outermost layer to the innermost layer, what is the order in which the knife penetrat

PLEASE Help!! What is the solution of the equation? Eliminate any extraneous solutions.

Select all that apply. In a linear function: Δy = 0 Δx = 0 Δy = n Δx = n Δy = -n Δx = -n

A food processor for $149.50 cash, or $5.00 down and $10.00 per month for 15 months

Which of the following is equal to the rational expression when x ≠ 5 or -1? [tex] \frac{(x-7)(x+1)}{(x+1)(x-5)} [/tex] a. [tex] \frac{x+1}{x-7} [/tex] b. [tex]

A gumball machine has 330 red gumballs. If the red gumballs are 75% of the total number of gumballs, how many gumballs are in the gumball machine?

In the Spanish-speaking world, which of the following is most likely found in the historic district of a city or town? A. a community of single-family homes B.

Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequences are always written 5' to 3

Which of the following is an example of social facilitation? A. The football player who practices hard so he can be on the varsity team B. The Olympic bic