mal1qb4l mal1qb4l

06-03-2021
Mathematics

contestada

work out the gradient of a line which has a gradient of 2 and passes through the point (1,4).

Respuesta :

06-03-2021

y=mx+c
m is gradient so y=2x+c
y=4 when x=1 so 4 = 2 x 1 + c
so c =2
so y=2x+2

Answer Link

Otras preguntas

Describe the similarities and differences between the cytokinesis mechanisms found in animal cells versus those in plant cells.

Suppose a yo-yo has a center shaft that has a 0.232 cm radius and that its string is being pulled. If the string is stationary and the yo-yo accelerates away fr

Neurons contain ________, which can receive signals from other neurons. axons mitochondria dendrites Golgi bodies

A scientist sequencing mRNA identifies the following strand: CUAUGUGUCGUAACAGCCGAUGACCCG What is the sequence of the amino acid chain this mRNA makes when it is

True or False The “Fair Deal” was President Truman’s name for his approach to foreign policy in the early days of the Cold War.

Tetanus patients exhibit ________ when muscle spasms causes them to arch their backs.

If glucose is absent, but so is lactose, the lac operon will be ________. activated repressed activated, but only partially mutated

You're seeking an ad format to support influencing consideration for your brand. You'd also like the ad to automatically adjusts its size, appearance, and forma

Which statement about trans fatty acids is true? A. They have a beneficial effect on cholesterol transport throughout the body. B. Their amounts are neve

What disease is most associated with Clostridium perfringens? endocarditis osteomyelitis gas gangrene rat bite fever