3' TAC ACC TTG GCG ACG ACT ACC GCG CAG TAG 5'. Mutated sequence: TACGACCTTGGCGACGACTACCGCGCAGTAG Transcribe and translate the normal sequence and the mutated sequence.
Identify what type of DNA mutation occurred. (insertion, deletion, or substitution)
Identify what type of protein change resulted. (frameshift, missense, nonsense, or silent)

Respuesta :

Answer:

who would know that?

Explanation: