dgonzalezjr1738 dgonzalezjr1738

09-12-2021
Health

contestada

How are food-contact surfaces to be handled between uses

A. Wash, rinse, and sanitize
B. Wipe down with cleaner
C. Clean and rinse
D.Wipe down with cleaner and sanitize

Respuesta :

hadi1088 hadi1088

09-12-2021

Answer:

B. Wipe down with cleaner

Answer Link

Otras preguntas

A student claims that the line tangent to the graph of f(x)=e^x at x=2 passes through the point (1,0). Is she correct ? Will the line tangent at x=3 pass throu

endocannabinoid binding to neuronal cb1 receptor causes: a) closure of pre-synaptic potassium channels b) closure of pre-synaptic calcium channels c) increase i

Which of the following statements are correct? Select the correct option(s) and click submit. Agile and Design Thinking are same Design Thinking is about Produc

there are about 1,265 school districts in the state of texas that generate an equivalent expression using prime factorization for the number 1,265 pls, help wh

Scenario 1: You are playing soccer and your team has just finished their third game of the day. The day has been very hot with temperatures in the 90s with no c

the following income statement and balance sheets for laser world are provided: laser world income statement for the year-ended december 31, 2021 sales revenue

our sequence is 5' - cttataaagccgtacaaaatctttctagcgcaaaa - 3'. for simplicity sake, only consider the 5' to 3' direction. consider the underlined c. would a cha

En una habitación hay 7 niños sentados en el suelo, cada uno de ellos tiene 7 mochilas. En cada mochila hay 7 gatos. Cada gato tiene 7 gatitos, y cada gatito ti

What is the area of the figure below? Round to the nearest hundredth when necessary.

2. show how to make the molecule below from the indicated starting material. include the reagents necessary and any synthetic intermediates. (2 pts) 3. explain