jessica8289 jessica8289

09-05-2022
Mathematics

contestada

a
You deposit $3000 into a bank account that pays 1.25% annual interest,
compounded monthly. How much interest does the account earn after 4 years?

Respuesta :

favourogbonna favourogbonna

09-05-2022

1.25 percent of 3000=37.5

37.5 times 4=150

3000-150=2850

Answer Link

Otras preguntas

Someone please help Brainliest Which of the following elements has the largest atomic radius? A: Potassium B: Calcium C: Cobalt D: Nickel

In what ways might the soviet union have benefited from gaining control of greece and turkey

On a 30-day easy-access loan, $1350 is borrowed at a 20% monthly fee. What is the total cost to repay the easy-access loan?

Dating the fossil at the site it was found, without benefit of laboratory equipment, would best be described as

In the ouchterlony test, if an unknown antigen contains only swine serum albumin, how many precipitin lines will form between it and the wells of antibodies for

2. Transcribe the following DNA segment 5’ agcgggatgagcgcatgtggcgcataactg3’ 3’ tcgccctactcgcgtacaccgcgtattgac5’ 3. Translate the mRNA of the

Earth pollution is the presence of harmful substances in the earths atmosphere

Each morning papa notes the birds feeding on his bird feeder. so far tis month he has seen 59 blue jays, 68 black crows, 12 red robins and 1 cardinal. if 300 bi

Tom with type AB blood marries Anna. They have two children: Eric with type B blood and Jessica with type A blood. Anna’s father Paul has type O blood, and her

Consider a solution containing 0.100 m fluoride ions and 0.126 m hydrogen fluoride. the concentration of hydrogen fluoride after addition of 5.00 ml of 0.0100 m