brownchiqk brownchiqk

08-03-2017
Mathematics

contestada

Solve the quadratic equation.

(x - 5)2 = 9

Respuesta :

texaschic101 texaschic101

08-03-2017

(x - 5)^2 = 9
(x - 5)(x - 5) = 9
x^2 - 10x + 25 = 9
x^2 - 10x + 25 - 9 = 0
x^2 - 10x + 16 = 0
(x - 8)(x - 2) = 0

x - 8 = 0
x = 8

x - 2 = 0
x = 2

solution : x = 8 and x = 2

Answer Link

Otras preguntas

Suppose the spread of a direct contact disease in a school is modeled by the exponential function P(t) = 2,000 1 + e3 − t where P(t) is the total number of p

The relative locations of a swing set, a garden, and a sandbox in Gina's backyard are shown in the diagram. What is the distance between the sandbox and garden?

Bones consist of cells suspended in an extracellular matrix. A bone is a type of

James purchased five bonds of face value of $1,000 that paid 5 percent annual interest rate. the total annual interest income of james for each year is _____.

What was the result of Bacons rebellion Thanks

Which expression represents the value, in dollars, of a certain number of quarters, q, and dimes, d? 0.35qd 0.35q + d 0.10q + 0.25d 0.25q + 0.10d

A) y= (x-1)(x+3)(x+2) B) y= -(x-1)(x+3)(x+2) C) y= (x+1)(x-3)(x-2) D) y= -(x-1)(x-3)(x-2)

Complete the equation for the standard form of the line that has an x-intercept of 7 and a y-intercept of 4.

Powers claimed by a president that are not expressed in the constitution but are inferred from it are called ____________ powers.

Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequences are always written 5' to 3