MiamiMomof2 MiamiMomof2

07-04-2017
History

contestada

What is number 7 plz tell me! I need help on this question! I only need number 7 to be answered! Thank you! :3 ;3

What is number 7 plz tell me I need help on this question I only need number 7 to be answered Thank you 3 3 class=

Respuesta :

jjmorgan jjmorgan

07-04-2017

They are the three sister's because they are the main crops in agriculture.

Answer Link

Аноним Аноним

07-04-2017

yay she right They are the three sister's because they are the main crops in agriculture.

Answer Link

Otras preguntas

An inflatable air balloon has a volume of 7.00 L and exerts a pressure of 104 kPa at 22°C. What pressure does the air in the balloon exert if the temperature is

10 POINTS! What is the constant of proportionality in this proportional relationship? x 2 4 6 8 y 5/6 1 2/3 2 1/2 3 1/3 A. 12 B. 5 C. 12/5 D. 5/12

PLEASE CAN SOMEONE HELP ME ? What are the effects of the Internet on the daily life of a teen? Write an outline using the outline format for a cause and effect

How do you simplify 3/4-2/3?

Is this a good grammar and everything for Spanish like to turn is for this ? I’ll give hella points, I need this ASAP

I need to know the Lewis structure for CCI4 H2O O2 N2 PH3 Please and thank you.

Click on the edit DNA, you will now see the original sequence used to make the protein. ATGCCGGGCGGCGAGAGCTTGCTAATTGGCTTATAA

What two verbs from the list require the context of a sentence to know their meaning? Multiple Choice a) Dar and Ver. b) Decir and Traer. c) Ser and Ir.

Which statement is reflected by Huck's decision to help Jim in his journey toward freedom? to show the importance of obeying social norms to show how contradict

A ratio is a comparison of two quantities. For example, the ratio of cows to pigs on a farm could be 1 to 3. For every 1 cow, there are 3 pigs. The ratio of cho