prayingfeet2880 prayingfeet2880

15-02-2024
Computers and Technology

contestada

What is the maximum length for the network cable between a workstation and a hub when using 10BaseFL technology?
a. 100 meters
b. 185 meters
c. 200 meters
d. 500 meters
e. 1000 meters

Respuesta :

jadenchafino jadenchafino

15-02-2024

Answer:b. 185 meters is ur answer

Explanation:

Answer Link

Otras preguntas

A traveling electromagnetic wave in a vacuum has an electric field amplitude of 50.9 V/m. Calculate the intensity ???? of this wave. Then, determine the amount

Set X consists of eight consecutive integers. Set Y consists of all the integers that result from adding 4 to each of the integers in set X and all the integers

What kind of ecosystem are exotic species especially threatening to? deserts marine ecosystems islands tropical forests

I need help with choosing correct verbs 1-10

What is the only common infection of the reproductive tract caused by a protozoan? gonorrhea chlamydia trichomoniasis candidiasis

Hannah lines up 6 plastic letters on a sign to spell her name. Each letter takes up 5/8 inch of space on the sign. The total amount of space taken up on the sig

A scientist sequencing mRNA identifies the following strand: CUAUGUGUCGUAACAGCCGAUGACCCG What is the sequence of the amino acid chain this mRNA makes when it is

a beach is 7.3 miles wide and 30 miles long. If one inch of rain falls on this beach, how many cubic feet of rain fell in this area?

1. No me gustan esos zapatos. Voy a comprar . (these) 2. ¿Vas a comprar ese traje o ? (this one) 3. Esta guayabera es bonita, pero prefiero . (that one) 4. E

According to the quantity theory: (A) unemployment is everywhere and always a monetary phenomenon. (B) inflation is everywhere and always a monetary phenomenon.