haileebug561 haileebug561

06-12-2017
Mathematics

contestada

Kevin gets and auto loan of $12,000 at 8% annual interest. The terms of his loan state that he has to pay 292.96 each month for 4 years. How much total interest will he have to pay?

A. $384
B. $960
C. $1171.84
D. $2062.08

Respuesta :

michaelcohen41oy7lzg michaelcohen41oy7lzg

07-12-2017

[tex]292.96 \times 48 = 14062.08 - 12000 = 2062.08[/tex]

Answer Link

Otras preguntas

You have a population in hardy-weinberg equilibrium for the m and n alleles. these alleles are codominant. the allele frequency of m is 0.4. what is the freque

Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequences are always written 5' to 3

Which organism in the food web above is sometimes a first-level consumer and sometimes a second-level consumer?Explain

If enough water pressure builds under the surface of the ground, the water can burst through cracks in the surface, forming a(n) _______.

Resposta do enigma na igreja a 5 velas entra 3 ladrao e 2 ladra cada ladrão leva 1 vela

A display screen at the airport shows the arrival and departure information of flights. Which data type is suitable to show the arrival of a flight? How can you

Tom made the box plots to compare the number of calories between his morning snacks and his afternoon snacks. George’s typical afternoon snack has about ______

A company issued 5-year, 7% bonds with a par value of $100,000. the market rate when the bonds were issued was 6.5%. the company received $102,105 cash for the

pls help asap and ill put up as king Which of the following statements is true? A. Both the dot plots A and B have the same mean. B. The mean of dot plot

[tex] \frac{10.5}{1.79} [/tex][tex] \frac{16}{2.19} [/tex]How would I find out the unit rate for these two equations?